Table of Contents : Accessing data :
Extended Access feature | Programmatic access

Extended Access Feature

To complete the Focus on dialog (menu 'View' > 'Focus on...'), Alamut® Visual provides a new Extended Access Feature allowing:

Access to Standard Genetic References: HUGO gene symbols and IDs, Reference sequences, RefSeqGenes and LRGs, UniProt IDs, Reference SNP IDs, COSMIC IDs and OMIM^® IDs.
Access to genomic, cDNA and protein positions.
Access to genomic and cDNA variants.
Easy access to multiple variants such as NGS candidate variants.
Easy access to multiple positions from BED files.

This feature is available from the Go to: input field at the top right of the Alamut® Visual main window:

Accessing standard genetic references

Example queries:

Query by reference Comment

MLH1 Official HGNC gene symbol

Breast cancer Disease, previous symbol or gene alias

HGNC:7127 HGNC Id

NM_000249.3 cDNA RefSeq Id

ENST00000231790 Ensembl Transcript Id (mapped to a NCBI RefSeq)

NG_007941.2 RefSeqGene Id

LRG_1 LRG Id

NP_000240.1 Protein RefSeq Id

P40692 UniProt Id

rs63750891 Reference SNP Id

COSM35380 COSMIC Id

OMIM:120436 OMIM^� Id

Query by reference	Comment
`MLH1`	Official HGNC gene symbol
`Breast cancer`	Disease, previous symbol or gene alias
`HGNC:7127`	HGNC Id
`NM_000249.3`	cDNA RefSeq Id
`ENST00000231790`	Ensembl Transcript Id (mapped to a NCBI RefSeq)
`NG_007941.2`	RefSeqGene Id
`LRG_1`	LRG Id
`NP_000240.1`	Protein RefSeq Id
`P40692`	UniProt Id
`rs63750891`	Reference SNP Id
`COSM35380`	COSMIC Id
`OMIM:120436`	OMIM^� Id

Accessing genomic, cDNA and protein positions

Example queries:

Query by position Comment

chr3:g.37050315 Standard gDNA query (implicitly on GRCh37)

3:37050315 Short gDNA query

3:36000000-38000000 Interval gDNA query (response is limited to 50 genes)

chr3(NCBI36):g.37025319 Use given assembly

hg18:3:37025319 Use given assembly (alternative writing)

g.37050315 gDNA query inside current gene

NM_000249.3:c.464 cDNA position query

NM_000249.3:464 Short cDNA position query

ENST00000231790:c.464 cDNA position query on Ensembl Trancript Id (mapped to a NCBI RefSeq)

NM_000249.3:p.155 Protein position query

NM_000249.3:p.Leu155Arg Protein substitution (only position is used)

NM_000249.3:L155R Protein substitution short query (only position is used)

P603R, K618R, Q689R Substitution list, e.g. from literature
(implicitly on current gene — only position is used)

Query by position	Comment
`chr3:g.37050315`	Standard gDNA query (implicitly on GRCh37)
`3:37050315`	Short gDNA query
`3:36000000-38000000`	Interval gDNA query (response is limited to 50 genes)
`chr3(NCBI36):g.37025319`	Use given assembly
`hg18:3:37025319`	Use given assembly (alternative writing)
`g.37050315`	gDNA query inside current gene
`NM_000249.3:c.464`	cDNA position query
`NM_000249.3:464`	Short cDNA position query
`ENST00000231790:c.464`	cDNA position query on Ensembl Trancript Id (mapped to a NCBI RefSeq)
`NM_000249.3:p.155`	Protein position query
`NM_000249.3:p.Leu155Arg`	Protein substitution (only position is used)
`NM_000249.3:L155R`	Protein substitution short query (only position is used)
`P603R, K618R, Q689R`	Substitution list, e.g. from literature (implicitly on current gene — only position is used)

In the above queries, a cDNA RefSeq can be replaced by a gene symbol (e.g., MLH1:c.464) or a RSG/LRG ID (e.g., LRG_1:c.359, NG_007941.2:p.211).

When a gene is already open in Alamut® Visual, neither RefSeq nor gene symbol may be given (in that case, protein substitutions require the standard prefix, e.g. p.L155R).

For gDNA queries, the default assembly is GRCh37.

Accessing genomic and cDNA variants

Example queries:

Query by variant Comment

chr3:g.37050315T>G Query with genomic variation (implicitly on GRCh37)

3:37050315T>G Short query with genomic variation

chr3(NCBI36):g.37025319T>G Use given assembly

hg18:3:37025319T>G Use given assembly (alternative writing)

NM_000249.3:c.464T>G cDNA variant

ENST00000231790:c.464T>G cDNA variant on Ensembl Trancript Id (mapped to a NCBI RefSeq)

c.157_160delGAGG, c.2157dupT and c.-64G>T Variant list, e.g. from literature (implicitly on current gene)

Query by variant	Comment
`chr3:g.37050315T>G`	Query with genomic variation (implicitly on GRCh37)
`3:37050315T>G`	Short query with genomic variation
`chr3(NCBI36):g.37025319T>G`	Use given assembly
`hg18:3:37025319T>G`	Use given assembly (alternative writing)
`NM_000249.3:c.464T>G`	cDNA variant
`ENST00000231790:c.464T>G`	cDNA variant on Ensembl Trancript Id (mapped to a NCBI RefSeq)
`c.157_160delGAGG, c.2157dupT and c.-64G>T`	Variant list, e.g. from literature (implicitly on current gene)

In the above cDNA query, RefSeq can be replaced by a gene symbol (e.g., MLH1:c.464T>G) or a RSG/LRG ID (e.g., LRG_1:c.359G>A).

For gDNA variants, the default assembly is GRCh37.

Viewing NGS output data

Several lines from an NGS output file can be copied and pasted into the input field:

The pasted data then shows up in a variant list. Double-click on an entry to jump from a variant to another:

Data can also be dragged and dropped in the entry field.

Lines from any BED file may also be pasted into the entry field. In that case, the only 2 first colums (chromosomes, gDNA start) will be taken into account. Be aware that, as BED files use 0-based coordinates, the focus within Alamut® Visual will be shifted by 1 nucleotide.

Query responses

Depending on the query type, Alamut® Visual can provide different response types:

Open gene Direct focus to a location

Create variant Position/Variant list

Select gene transcript Select gene

For each gene result, the preferred assembly and/or transcript, if any, is automatically selected.

Other useful functionalities

Example queries (when a gene is already displayed):

Query Comment

BED<http://www.interactive-biosoftware.com/alamut/doc/2.15/templates/MLH1.bed Query with file format and URL

GAAGGGAACCTGATTGGATTACCCCTTCTGATT Query with nucleotide sequence

BAM<http://www.your-institution.org/NGS/alignment.bam Query with file format and URL

Open gene	Direct focus to a location

Create variant	Position/Variant list

Select gene transcript	Select gene

Query	Comment
`BED<http://www.interactive-biosoftware.com/alamut/doc/2.15/templates/MLH1.bed`	Query with file format and URL
`GAAGGGAACCTGATTGGATTACCCCTTCTGATT`	Query with nucleotide sequence
`BAM<http://www.your-institution.org/NGS/alignment.bam`	Query with file format and URL